ID: 905309000

View in Genome Browser
Species Human (GRCh38)
Location 1:37036755-37036777
Sequence CAGCCTGTGCTGCTTCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905309000_905309009 9 Left 905309000 1:37036755-37036777 CCCCAGGGAAGCAGCACAGGCTG No data
Right 905309009 1:37036787-37036809 CTCCTGCATCCCAGAGTGGGCGG No data
905309000_905309014 30 Left 905309000 1:37036755-37036777 CCCCAGGGAAGCAGCACAGGCTG No data
Right 905309014 1:37036808-37036830 GGGAGTTACCCAGCACGCTGCGG No data
905309000_905309010 10 Left 905309000 1:37036755-37036777 CCCCAGGGAAGCAGCACAGGCTG No data
Right 905309010 1:37036788-37036810 TCCTGCATCCCAGAGTGGGCGGG No data
905309000_905309007 6 Left 905309000 1:37036755-37036777 CCCCAGGGAAGCAGCACAGGCTG No data
Right 905309007 1:37036784-37036806 CTCCTCCTGCATCCCAGAGTGGG No data
905309000_905309006 5 Left 905309000 1:37036755-37036777 CCCCAGGGAAGCAGCACAGGCTG No data
Right 905309006 1:37036783-37036805 GCTCCTCCTGCATCCCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905309000 Original CRISPR CAGCCTGTGCTGCTTCCCTG GGG (reversed) Intergenic
No off target data available for this crispr