ID: 905309001

View in Genome Browser
Species Human (GRCh38)
Location 1:37036756-37036778
Sequence CCAGCCTGTGCTGCTTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905309001_905309009 8 Left 905309001 1:37036756-37036778 CCCAGGGAAGCAGCACAGGCTGG No data
Right 905309009 1:37036787-37036809 CTCCTGCATCCCAGAGTGGGCGG No data
905309001_905309007 5 Left 905309001 1:37036756-37036778 CCCAGGGAAGCAGCACAGGCTGG No data
Right 905309007 1:37036784-37036806 CTCCTCCTGCATCCCAGAGTGGG No data
905309001_905309006 4 Left 905309001 1:37036756-37036778 CCCAGGGAAGCAGCACAGGCTGG No data
Right 905309006 1:37036783-37036805 GCTCCTCCTGCATCCCAGAGTGG No data
905309001_905309010 9 Left 905309001 1:37036756-37036778 CCCAGGGAAGCAGCACAGGCTGG No data
Right 905309010 1:37036788-37036810 TCCTGCATCCCAGAGTGGGCGGG No data
905309001_905309014 29 Left 905309001 1:37036756-37036778 CCCAGGGAAGCAGCACAGGCTGG No data
Right 905309014 1:37036808-37036830 GGGAGTTACCCAGCACGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905309001 Original CRISPR CCAGCCTGTGCTGCTTCCCT GGG (reversed) Intergenic
No off target data available for this crispr