ID: 905309002

View in Genome Browser
Species Human (GRCh38)
Location 1:37036756-37036778
Sequence CCCAGGGAAGCAGCACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905308988_905309002 25 Left 905308988 1:37036708-37036730 CCCAGAGGGTGAGAGTGTGGCTC No data
Right 905309002 1:37036756-37036778 CCCAGGGAAGCAGCACAGGCTGG No data
905308991_905309002 0 Left 905308991 1:37036733-37036755 CCACCTGCGAGCCCCCTCGGCGC No data
Right 905309002 1:37036756-37036778 CCCAGGGAAGCAGCACAGGCTGG No data
905308992_905309002 -3 Left 905308992 1:37036736-37036758 CCTGCGAGCCCCCTCGGCGCCCC No data
Right 905309002 1:37036756-37036778 CCCAGGGAAGCAGCACAGGCTGG No data
905308987_905309002 26 Left 905308987 1:37036707-37036729 CCCCAGAGGGTGAGAGTGTGGCT No data
Right 905309002 1:37036756-37036778 CCCAGGGAAGCAGCACAGGCTGG No data
905308986_905309002 27 Left 905308986 1:37036706-37036728 CCCCCAGAGGGTGAGAGTGTGGC No data
Right 905309002 1:37036756-37036778 CCCAGGGAAGCAGCACAGGCTGG No data
905308989_905309002 24 Left 905308989 1:37036709-37036731 CCAGAGGGTGAGAGTGTGGCTCT No data
Right 905309002 1:37036756-37036778 CCCAGGGAAGCAGCACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905309002 Original CRISPR CCCAGGGAAGCAGCACAGGC TGG Intergenic
No off target data available for this crispr