ID: 905309003

View in Genome Browser
Species Human (GRCh38)
Location 1:37036757-37036779
Sequence CCCAGCCTGTGCTGCTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905309003_905309010 8 Left 905309003 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data
Right 905309010 1:37036788-37036810 TCCTGCATCCCAGAGTGGGCGGG No data
905309003_905309014 28 Left 905309003 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data
Right 905309014 1:37036808-37036830 GGGAGTTACCCAGCACGCTGCGG No data
905309003_905309006 3 Left 905309003 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data
Right 905309006 1:37036783-37036805 GCTCCTCCTGCATCCCAGAGTGG No data
905309003_905309007 4 Left 905309003 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data
Right 905309007 1:37036784-37036806 CTCCTCCTGCATCCCAGAGTGGG No data
905309003_905309009 7 Left 905309003 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data
Right 905309009 1:37036787-37036809 CTCCTGCATCCCAGAGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905309003 Original CRISPR CCCAGCCTGTGCTGCTTCCC TGG (reversed) Intergenic
No off target data available for this crispr