ID: 905309004

View in Genome Browser
Species Human (GRCh38)
Location 1:37036757-37036779
Sequence CCAGGGAAGCAGCACAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905308992_905309004 -2 Left 905308992 1:37036736-37036758 CCTGCGAGCCCCCTCGGCGCCCC No data
Right 905309004 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data
905308989_905309004 25 Left 905308989 1:37036709-37036731 CCAGAGGGTGAGAGTGTGGCTCT No data
Right 905309004 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data
905308987_905309004 27 Left 905308987 1:37036707-37036729 CCCCAGAGGGTGAGAGTGTGGCT No data
Right 905309004 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data
905308995_905309004 -10 Left 905308995 1:37036744-37036766 CCCCCTCGGCGCCCCAGGGAAGC No data
Right 905309004 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data
905308986_905309004 28 Left 905308986 1:37036706-37036728 CCCCCAGAGGGTGAGAGTGTGGC No data
Right 905309004 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data
905308988_905309004 26 Left 905308988 1:37036708-37036730 CCCAGAGGGTGAGAGTGTGGCTC No data
Right 905309004 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data
905308991_905309004 1 Left 905308991 1:37036733-37036755 CCACCTGCGAGCCCCCTCGGCGC No data
Right 905309004 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905309004 Original CRISPR CCAGGGAAGCAGCACAGGCT GGG Intergenic
No off target data available for this crispr