ID: 905309009

View in Genome Browser
Species Human (GRCh38)
Location 1:37036787-37036809
Sequence CTCCTGCATCCCAGAGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905308992_905309009 28 Left 905308992 1:37036736-37036758 CCTGCGAGCCCCCTCGGCGCCCC No data
Right 905309009 1:37036787-37036809 CTCCTGCATCCCAGAGTGGGCGG No data
905308997_905309009 18 Left 905308997 1:37036746-37036768 CCCTCGGCGCCCCAGGGAAGCAG No data
Right 905309009 1:37036787-37036809 CTCCTGCATCCCAGAGTGGGCGG No data
905309003_905309009 7 Left 905309003 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data
Right 905309009 1:37036787-37036809 CTCCTGCATCCCAGAGTGGGCGG No data
905308998_905309009 17 Left 905308998 1:37036747-37036769 CCTCGGCGCCCCAGGGAAGCAGC No data
Right 905309009 1:37036787-37036809 CTCCTGCATCCCAGAGTGGGCGG No data
905308996_905309009 19 Left 905308996 1:37036745-37036767 CCCCTCGGCGCCCCAGGGAAGCA No data
Right 905309009 1:37036787-37036809 CTCCTGCATCCCAGAGTGGGCGG No data
905309000_905309009 9 Left 905309000 1:37036755-37036777 CCCCAGGGAAGCAGCACAGGCTG No data
Right 905309009 1:37036787-37036809 CTCCTGCATCCCAGAGTGGGCGG No data
905308995_905309009 20 Left 905308995 1:37036744-37036766 CCCCCTCGGCGCCCCAGGGAAGC No data
Right 905309009 1:37036787-37036809 CTCCTGCATCCCAGAGTGGGCGG No data
905309001_905309009 8 Left 905309001 1:37036756-37036778 CCCAGGGAAGCAGCACAGGCTGG No data
Right 905309009 1:37036787-37036809 CTCCTGCATCCCAGAGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905309009 Original CRISPR CTCCTGCATCCCAGAGTGGG CGG Intergenic
No off target data available for this crispr