ID: 905309014

View in Genome Browser
Species Human (GRCh38)
Location 1:37036808-37036830
Sequence GGGAGTTACCCAGCACGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905309005_905309014 5 Left 905309005 1:37036780-37036802 CCTGCTCCTCCTGCATCCCAGAG No data
Right 905309014 1:37036808-37036830 GGGAGTTACCCAGCACGCTGCGG No data
905309003_905309014 28 Left 905309003 1:37036757-37036779 CCAGGGAAGCAGCACAGGCTGGG No data
Right 905309014 1:37036808-37036830 GGGAGTTACCCAGCACGCTGCGG No data
905309011_905309014 -4 Left 905309011 1:37036789-37036811 CCTGCATCCCAGAGTGGGCGGGA No data
Right 905309014 1:37036808-37036830 GGGAGTTACCCAGCACGCTGCGG No data
905309000_905309014 30 Left 905309000 1:37036755-37036777 CCCCAGGGAAGCAGCACAGGCTG No data
Right 905309014 1:37036808-37036830 GGGAGTTACCCAGCACGCTGCGG No data
905309001_905309014 29 Left 905309001 1:37036756-37036778 CCCAGGGAAGCAGCACAGGCTGG No data
Right 905309014 1:37036808-37036830 GGGAGTTACCCAGCACGCTGCGG No data
905309008_905309014 -1 Left 905309008 1:37036786-37036808 CCTCCTGCATCCCAGAGTGGGCG No data
Right 905309014 1:37036808-37036830 GGGAGTTACCCAGCACGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905309014 Original CRISPR GGGAGTTACCCAGCACGCTG CGG Intergenic
No off target data available for this crispr