ID: 905310062

View in Genome Browser
Species Human (GRCh38)
Location 1:37042950-37042972
Sequence TCTCTGAGTGTCCTGGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905310062_905310070 17 Left 905310062 1:37042950-37042972 CCAAGCACCAGGACACTCAGAGA No data
Right 905310070 1:37042990-37043012 CAGACAGGAACCAGGTGATGGGG No data
905310062_905310066 2 Left 905310062 1:37042950-37042972 CCAAGCACCAGGACACTCAGAGA No data
Right 905310066 1:37042975-37042997 CACAGAGGTTGAGGACAGACAGG No data
905310062_905310071 21 Left 905310062 1:37042950-37042972 CCAAGCACCAGGACACTCAGAGA No data
Right 905310071 1:37042994-37043016 CAGGAACCAGGTGATGGGGATGG No data
905310062_905310069 16 Left 905310062 1:37042950-37042972 CCAAGCACCAGGACACTCAGAGA No data
Right 905310069 1:37042989-37043011 ACAGACAGGAACCAGGTGATGGG No data
905310062_905310065 -7 Left 905310062 1:37042950-37042972 CCAAGCACCAGGACACTCAGAGA No data
Right 905310065 1:37042966-37042988 TCAGAGAAGCACAGAGGTTGAGG No data
905310062_905310067 9 Left 905310062 1:37042950-37042972 CCAAGCACCAGGACACTCAGAGA No data
Right 905310067 1:37042982-37043004 GTTGAGGACAGACAGGAACCAGG No data
905310062_905310068 15 Left 905310062 1:37042950-37042972 CCAAGCACCAGGACACTCAGAGA No data
Right 905310068 1:37042988-37043010 GACAGACAGGAACCAGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905310062 Original CRISPR TCTCTGAGTGTCCTGGTGCT TGG (reversed) Intergenic
No off target data available for this crispr