ID: 905310063

View in Genome Browser
Species Human (GRCh38)
Location 1:37042957-37042979
Sequence CTGTGCTTCTCTGAGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905310063_905310068 8 Left 905310063 1:37042957-37042979 CCAGGACACTCAGAGAAGCACAG No data
Right 905310068 1:37042988-37043010 GACAGACAGGAACCAGGTGATGG No data
905310063_905310067 2 Left 905310063 1:37042957-37042979 CCAGGACACTCAGAGAAGCACAG No data
Right 905310067 1:37042982-37043004 GTTGAGGACAGACAGGAACCAGG No data
905310063_905310070 10 Left 905310063 1:37042957-37042979 CCAGGACACTCAGAGAAGCACAG No data
Right 905310070 1:37042990-37043012 CAGACAGGAACCAGGTGATGGGG No data
905310063_905310069 9 Left 905310063 1:37042957-37042979 CCAGGACACTCAGAGAAGCACAG No data
Right 905310069 1:37042989-37043011 ACAGACAGGAACCAGGTGATGGG No data
905310063_905310066 -5 Left 905310063 1:37042957-37042979 CCAGGACACTCAGAGAAGCACAG No data
Right 905310066 1:37042975-37042997 CACAGAGGTTGAGGACAGACAGG No data
905310063_905310071 14 Left 905310063 1:37042957-37042979 CCAGGACACTCAGAGAAGCACAG No data
Right 905310071 1:37042994-37043016 CAGGAACCAGGTGATGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905310063 Original CRISPR CTGTGCTTCTCTGAGTGTCC TGG (reversed) Intergenic
No off target data available for this crispr