ID: 905310065

View in Genome Browser
Species Human (GRCh38)
Location 1:37042966-37042988
Sequence TCAGAGAAGCACAGAGGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905310059_905310065 26 Left 905310059 1:37042917-37042939 CCCTTTGCTCTCAAGCTTACACA No data
Right 905310065 1:37042966-37042988 TCAGAGAAGCACAGAGGTTGAGG No data
905310062_905310065 -7 Left 905310062 1:37042950-37042972 CCAAGCACCAGGACACTCAGAGA No data
Right 905310065 1:37042966-37042988 TCAGAGAAGCACAGAGGTTGAGG No data
905310060_905310065 25 Left 905310060 1:37042918-37042940 CCTTTGCTCTCAAGCTTACACAC No data
Right 905310065 1:37042966-37042988 TCAGAGAAGCACAGAGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905310065 Original CRISPR TCAGAGAAGCACAGAGGTTG AGG Intergenic
No off target data available for this crispr