ID: 905310069

View in Genome Browser
Species Human (GRCh38)
Location 1:37042989-37043011
Sequence ACAGACAGGAACCAGGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905310063_905310069 9 Left 905310063 1:37042957-37042979 CCAGGACACTCAGAGAAGCACAG No data
Right 905310069 1:37042989-37043011 ACAGACAGGAACCAGGTGATGGG No data
905310062_905310069 16 Left 905310062 1:37042950-37042972 CCAAGCACCAGGACACTCAGAGA No data
Right 905310069 1:37042989-37043011 ACAGACAGGAACCAGGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905310069 Original CRISPR ACAGACAGGAACCAGGTGAT GGG Intergenic
No off target data available for this crispr