ID: 905310070 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:37042990-37043012 |
Sequence | CAGACAGGAACCAGGTGATG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
905310062_905310070 | 17 | Left | 905310062 | 1:37042950-37042972 | CCAAGCACCAGGACACTCAGAGA | No data | ||
Right | 905310070 | 1:37042990-37043012 | CAGACAGGAACCAGGTGATGGGG | No data | ||||
905310063_905310070 | 10 | Left | 905310063 | 1:37042957-37042979 | CCAGGACACTCAGAGAAGCACAG | No data | ||
Right | 905310070 | 1:37042990-37043012 | CAGACAGGAACCAGGTGATGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
905310070 | Original CRISPR | CAGACAGGAACCAGGTGATG GGG | Intergenic | ||
No off target data available for this crispr |