ID: 905310071

View in Genome Browser
Species Human (GRCh38)
Location 1:37042994-37043016
Sequence CAGGAACCAGGTGATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905310062_905310071 21 Left 905310062 1:37042950-37042972 CCAAGCACCAGGACACTCAGAGA No data
Right 905310071 1:37042994-37043016 CAGGAACCAGGTGATGGGGATGG No data
905310063_905310071 14 Left 905310063 1:37042957-37042979 CCAGGACACTCAGAGAAGCACAG No data
Right 905310071 1:37042994-37043016 CAGGAACCAGGTGATGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905310071 Original CRISPR CAGGAACCAGGTGATGGGGA TGG Intergenic
No off target data available for this crispr