ID: 905310180 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:37043574-37043596 |
| Sequence | CTGTCACAGGGGGAGTAGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 905310167_905310180 | 26 | Left | 905310167 | 1:37043525-37043547 | CCCTCAACCATGTCTTTATGATT | No data | ||
| Right | 905310180 | 1:37043574-37043596 | CTGTCACAGGGGGAGTAGGAGGG | No data | ||||
| 905310169_905310180 | 19 | Left | 905310169 | 1:37043532-37043554 | CCATGTCTTTATGATTTTTTTTC | No data | ||
| Right | 905310180 | 1:37043574-37043596 | CTGTCACAGGGGGAGTAGGAGGG | No data | ||||
| 905310168_905310180 | 25 | Left | 905310168 | 1:37043526-37043548 | CCTCAACCATGTCTTTATGATTT | No data | ||
| Right | 905310180 | 1:37043574-37043596 | CTGTCACAGGGGGAGTAGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 905310180 | Original CRISPR | CTGTCACAGGGGGAGTAGGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||