ID: 905310180

View in Genome Browser
Species Human (GRCh38)
Location 1:37043574-37043596
Sequence CTGTCACAGGGGGAGTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905310167_905310180 26 Left 905310167 1:37043525-37043547 CCCTCAACCATGTCTTTATGATT No data
Right 905310180 1:37043574-37043596 CTGTCACAGGGGGAGTAGGAGGG No data
905310169_905310180 19 Left 905310169 1:37043532-37043554 CCATGTCTTTATGATTTTTTTTC No data
Right 905310180 1:37043574-37043596 CTGTCACAGGGGGAGTAGGAGGG No data
905310168_905310180 25 Left 905310168 1:37043526-37043548 CCTCAACCATGTCTTTATGATTT No data
Right 905310180 1:37043574-37043596 CTGTCACAGGGGGAGTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905310180 Original CRISPR CTGTCACAGGGGGAGTAGGA GGG Intergenic
No off target data available for this crispr