ID: 905313724

View in Genome Browser
Species Human (GRCh38)
Location 1:37067967-37067989
Sequence CCTGACCAGGGCTGCCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905313710_905313724 29 Left 905313710 1:37067915-37067937 CCAGGCCTTCTTCGGCCCCTTCA No data
Right 905313724 1:37067967-37067989 CCTGACCAGGGCTGCCATGGAGG No data
905313714_905313724 12 Left 905313714 1:37067932-37067954 CCTTCAACCCTCATACTCACTTG No data
Right 905313724 1:37067967-37067989 CCTGACCAGGGCTGCCATGGAGG No data
905313716_905313724 4 Left 905313716 1:37067940-37067962 CCTCATACTCACTTGCTCTTGAC No data
Right 905313724 1:37067967-37067989 CCTGACCAGGGCTGCCATGGAGG No data
905313711_905313724 24 Left 905313711 1:37067920-37067942 CCTTCTTCGGCCCCTTCAACCCT No data
Right 905313724 1:37067967-37067989 CCTGACCAGGGCTGCCATGGAGG No data
905313712_905313724 14 Left 905313712 1:37067930-37067952 CCCCTTCAACCCTCATACTCACT No data
Right 905313724 1:37067967-37067989 CCTGACCAGGGCTGCCATGGAGG No data
905313713_905313724 13 Left 905313713 1:37067931-37067953 CCCTTCAACCCTCATACTCACTT No data
Right 905313724 1:37067967-37067989 CCTGACCAGGGCTGCCATGGAGG No data
905313715_905313724 5 Left 905313715 1:37067939-37067961 CCCTCATACTCACTTGCTCTTGA No data
Right 905313724 1:37067967-37067989 CCTGACCAGGGCTGCCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905313724 Original CRISPR CCTGACCAGGGCTGCCATGG AGG Intergenic
No off target data available for this crispr