ID: 905318345

View in Genome Browser
Species Human (GRCh38)
Location 1:37097676-37097698
Sequence GGGACCAAGTCACTCCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905318345_905318359 26 Left 905318345 1:37097676-37097698 CCTACCTGGAGTGACTTGGTCCC No data
Right 905318359 1:37097725-37097747 CCTAGCAGCCGTAATGGCTGCGG No data
905318345_905318355 20 Left 905318345 1:37097676-37097698 CCTACCTGGAGTGACTTGGTCCC No data
Right 905318355 1:37097719-37097741 CCCGGCCCTAGCAGCCGTAATGG No data
905318345_905318351 2 Left 905318345 1:37097676-37097698 CCTACCTGGAGTGACTTGGTCCC No data
Right 905318351 1:37097701-37097723 ATGGGCTAAGCCTGAGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905318345 Original CRISPR GGGACCAAGTCACTCCAGGT AGG (reversed) Intergenic
No off target data available for this crispr