ID: 905323108

View in Genome Browser
Species Human (GRCh38)
Location 1:37131649-37131671
Sequence CCTTCACCTAGGGCAGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905323108_905323115 4 Left 905323108 1:37131649-37131671 CCCAGTCCTGCCCTAGGTGAAGG No data
Right 905323115 1:37131676-37131698 AGGAACCCAAGTATAGCCATTGG No data
905323108_905323118 15 Left 905323108 1:37131649-37131671 CCCAGTCCTGCCCTAGGTGAAGG No data
Right 905323118 1:37131687-37131709 TATAGCCATTGGCAACTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905323108 Original CRISPR CCTTCACCTAGGGCAGGACT GGG (reversed) Intergenic
No off target data available for this crispr