ID: 905324114

View in Genome Browser
Species Human (GRCh38)
Location 1:37138380-37138402
Sequence CAGACAGATGGAGCTGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905324114_905324118 -4 Left 905324114 1:37138380-37138402 CCAGGAGCAGCTCCATCTGTCTG No data
Right 905324118 1:37138399-37138421 TCTGTGATCCAGGGCACTCATGG No data
905324114_905324120 18 Left 905324114 1:37138380-37138402 CCAGGAGCAGCTCCATCTGTCTG No data
Right 905324120 1:37138421-37138443 GTGAGAACCTACTGAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905324114 Original CRISPR CAGACAGATGGAGCTGCTCC TGG (reversed) Intergenic