ID: 905328778

View in Genome Browser
Species Human (GRCh38)
Location 1:37177283-37177305
Sequence CTGTCGCCATAGTTTGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905328770_905328778 19 Left 905328770 1:37177241-37177263 CCAGAGAGTGGCTGCAAGCGTCC No data
Right 905328778 1:37177283-37177305 CTGTCGCCATAGTTTGGGCTTGG No data
905328773_905328778 -2 Left 905328773 1:37177262-37177284 CCTCAGGAGGCAAAAACCCTGCT No data
Right 905328778 1:37177283-37177305 CTGTCGCCATAGTTTGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905328778 Original CRISPR CTGTCGCCATAGTTTGGGCT TGG Intergenic
No off target data available for this crispr