ID: 905328778 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:37177283-37177305 |
| Sequence | CTGTCGCCATAGTTTGGGCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 905328770_905328778 | 19 | Left | 905328770 | 1:37177241-37177263 | CCAGAGAGTGGCTGCAAGCGTCC | No data | ||
| Right | 905328778 | 1:37177283-37177305 | CTGTCGCCATAGTTTGGGCTTGG | No data | ||||
| 905328773_905328778 | -2 | Left | 905328773 | 1:37177262-37177284 | CCTCAGGAGGCAAAAACCCTGCT | No data | ||
| Right | 905328778 | 1:37177283-37177305 | CTGTCGCCATAGTTTGGGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 905328778 | Original CRISPR | CTGTCGCCATAGTTTGGGCT TGG | Intergenic | ||
| No off target data available for this crispr | |||||