ID: 905329369

View in Genome Browser
Species Human (GRCh38)
Location 1:37181577-37181599
Sequence TCCCCAGGGGAGCCCCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905329369_905329374 23 Left 905329369 1:37181577-37181599 CCTCTTTGGGGCTCCCCTGGGGA No data
Right 905329374 1:37181623-37181645 AATGCCCTGCCTGCCTTCTCTGG No data
905329369_905329375 24 Left 905329369 1:37181577-37181599 CCTCTTTGGGGCTCCCCTGGGGA No data
Right 905329375 1:37181624-37181646 ATGCCCTGCCTGCCTTCTCTGGG No data
905329369_905329373 -1 Left 905329369 1:37181577-37181599 CCTCTTTGGGGCTCCCCTGGGGA No data
Right 905329373 1:37181599-37181621 AGTTATAAACAAAATGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905329369 Original CRISPR TCCCCAGGGGAGCCCCAAAG AGG (reversed) Intergenic
No off target data available for this crispr