ID: 905339029

View in Genome Browser
Species Human (GRCh38)
Location 1:37265789-37265811
Sequence CTGCCCCGAGCCTTGGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905339029_905339037 -8 Left 905339029 1:37265789-37265811 CCCAAGGCCAAGGCTCGGGGCAG No data
Right 905339037 1:37265804-37265826 CGGGGCAGGAAAGGGGGCATTGG No data
905339029_905339043 28 Left 905339029 1:37265789-37265811 CCCAAGGCCAAGGCTCGGGGCAG No data
Right 905339043 1:37265840-37265862 CCTAAAAGCCTCCTGAAGCCAGG No data
905339029_905339038 -7 Left 905339029 1:37265789-37265811 CCCAAGGCCAAGGCTCGGGGCAG No data
Right 905339038 1:37265805-37265827 GGGGCAGGAAAGGGGGCATTGGG No data
905339029_905339039 -1 Left 905339029 1:37265789-37265811 CCCAAGGCCAAGGCTCGGGGCAG No data
Right 905339039 1:37265811-37265833 GGAAAGGGGGCATTGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905339029 Original CRISPR CTGCCCCGAGCCTTGGCCTT GGG (reversed) Intergenic