ID: 905339030

View in Genome Browser
Species Human (GRCh38)
Location 1:37265790-37265812
Sequence CCTGCCCCGAGCCTTGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905339030_905339037 -9 Left 905339030 1:37265790-37265812 CCAAGGCCAAGGCTCGGGGCAGG No data
Right 905339037 1:37265804-37265826 CGGGGCAGGAAAGGGGGCATTGG No data
905339030_905339043 27 Left 905339030 1:37265790-37265812 CCAAGGCCAAGGCTCGGGGCAGG No data
Right 905339043 1:37265840-37265862 CCTAAAAGCCTCCTGAAGCCAGG No data
905339030_905339039 -2 Left 905339030 1:37265790-37265812 CCAAGGCCAAGGCTCGGGGCAGG No data
Right 905339039 1:37265811-37265833 GGAAAGGGGGCATTGGGCAGAGG No data
905339030_905339038 -8 Left 905339030 1:37265790-37265812 CCAAGGCCAAGGCTCGGGGCAGG No data
Right 905339038 1:37265805-37265827 GGGGCAGGAAAGGGGGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905339030 Original CRISPR CCTGCCCCGAGCCTTGGCCT TGG (reversed) Intergenic