ID: 905339033

View in Genome Browser
Species Human (GRCh38)
Location 1:37265796-37265818
Sequence CCCTTTCCTGCCCCGAGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905339033_905339039 -8 Left 905339033 1:37265796-37265818 CCAAGGCTCGGGGCAGGAAAGGG No data
Right 905339039 1:37265811-37265833 GGAAAGGGGGCATTGGGCAGAGG No data
905339033_905339043 21 Left 905339033 1:37265796-37265818 CCAAGGCTCGGGGCAGGAAAGGG No data
Right 905339043 1:37265840-37265862 CCTAAAAGCCTCCTGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905339033 Original CRISPR CCCTTTCCTGCCCCGAGCCT TGG (reversed) Intergenic