ID: 905339038

View in Genome Browser
Species Human (GRCh38)
Location 1:37265805-37265827
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905339029_905339038 -7 Left 905339029 1:37265789-37265811 CCCAAGGCCAAGGCTCGGGGCAG No data
Right 905339038 1:37265805-37265827 GGGGCAGGAAAGGGGGCATTGGG No data
905339030_905339038 -8 Left 905339030 1:37265790-37265812 CCAAGGCCAAGGCTCGGGGCAGG No data
Right 905339038 1:37265805-37265827 GGGGCAGGAAAGGGGGCATTGGG No data
905339022_905339038 19 Left 905339022 1:37265763-37265785 CCCTACTGTTCAGGCTCGGTCAA No data
Right 905339038 1:37265805-37265827 GGGGCAGGAAAGGGGGCATTGGG No data
905339023_905339038 18 Left 905339023 1:37265764-37265786 CCTACTGTTCAGGCTCGGTCAAC No data
Right 905339038 1:37265805-37265827 GGGGCAGGAAAGGGGGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type