ID: 905339039

View in Genome Browser
Species Human (GRCh38)
Location 1:37265811-37265833
Sequence GGAAAGGGGGCATTGGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905339022_905339039 25 Left 905339022 1:37265763-37265785 CCCTACTGTTCAGGCTCGGTCAA No data
Right 905339039 1:37265811-37265833 GGAAAGGGGGCATTGGGCAGAGG No data
905339029_905339039 -1 Left 905339029 1:37265789-37265811 CCCAAGGCCAAGGCTCGGGGCAG No data
Right 905339039 1:37265811-37265833 GGAAAGGGGGCATTGGGCAGAGG No data
905339030_905339039 -2 Left 905339030 1:37265790-37265812 CCAAGGCCAAGGCTCGGGGCAGG No data
Right 905339039 1:37265811-37265833 GGAAAGGGGGCATTGGGCAGAGG No data
905339023_905339039 24 Left 905339023 1:37265764-37265786 CCTACTGTTCAGGCTCGGTCAAC No data
Right 905339039 1:37265811-37265833 GGAAAGGGGGCATTGGGCAGAGG No data
905339033_905339039 -8 Left 905339033 1:37265796-37265818 CCAAGGCTCGGGGCAGGAAAGGG No data
Right 905339039 1:37265811-37265833 GGAAAGGGGGCATTGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905339039 Original CRISPR GGAAAGGGGGCATTGGGCAG AGG Intergenic