ID: 905339043

View in Genome Browser
Species Human (GRCh38)
Location 1:37265840-37265862
Sequence CCTAAAAGCCTCCTGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905339029_905339043 28 Left 905339029 1:37265789-37265811 CCCAAGGCCAAGGCTCGGGGCAG No data
Right 905339043 1:37265840-37265862 CCTAAAAGCCTCCTGAAGCCAGG No data
905339033_905339043 21 Left 905339033 1:37265796-37265818 CCAAGGCTCGGGGCAGGAAAGGG No data
Right 905339043 1:37265840-37265862 CCTAAAAGCCTCCTGAAGCCAGG No data
905339030_905339043 27 Left 905339030 1:37265790-37265812 CCAAGGCCAAGGCTCGGGGCAGG No data
Right 905339043 1:37265840-37265862 CCTAAAAGCCTCCTGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905339043 Original CRISPR CCTAAAAGCCTCCTGAAGCC AGG Intergenic
No off target data available for this crispr