ID: 905339105

View in Genome Browser
Species Human (GRCh38)
Location 1:37266184-37266206
Sequence CCTGCCATGGTGAGGTATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905339097_905339105 -9 Left 905339097 1:37266170-37266192 CCTCCCTGCCACCTCCTGCCATG No data
Right 905339105 1:37266184-37266206 CCTGCCATGGTGAGGTATTCAGG No data
905339096_905339105 7 Left 905339096 1:37266154-37266176 CCTGGGAGGGTCTGTTCCTCCCT No data
Right 905339105 1:37266184-37266206 CCTGCCATGGTGAGGTATTCAGG No data
905339091_905339105 20 Left 905339091 1:37266141-37266163 CCAAGCCCCTCTGCCTGGGAGGG No data
Right 905339105 1:37266184-37266206 CCTGCCATGGTGAGGTATTCAGG No data
905339094_905339105 14 Left 905339094 1:37266147-37266169 CCCTCTGCCTGGGAGGGTCTGTT No data
Right 905339105 1:37266184-37266206 CCTGCCATGGTGAGGTATTCAGG No data
905339093_905339105 15 Left 905339093 1:37266146-37266168 CCCCTCTGCCTGGGAGGGTCTGT No data
Right 905339105 1:37266184-37266206 CCTGCCATGGTGAGGTATTCAGG No data
905339095_905339105 13 Left 905339095 1:37266148-37266170 CCTCTGCCTGGGAGGGTCTGTTC No data
Right 905339105 1:37266184-37266206 CCTGCCATGGTGAGGTATTCAGG No data
905339089_905339105 21 Left 905339089 1:37266140-37266162 CCCAAGCCCCTCTGCCTGGGAGG No data
Right 905339105 1:37266184-37266206 CCTGCCATGGTGAGGTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905339105 Original CRISPR CCTGCCATGGTGAGGTATTC AGG Intergenic
No off target data available for this crispr