ID: 905341340

View in Genome Browser
Species Human (GRCh38)
Location 1:37280037-37280059
Sequence AAGCAGAGCCAACAAGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905341339_905341340 -10 Left 905341339 1:37280024-37280046 CCGGAAGGTATATAAGCAGAGCC No data
Right 905341340 1:37280037-37280059 AAGCAGAGCCAACAAGAGATTGG No data
905341337_905341340 -1 Left 905341337 1:37280015-37280037 CCTGGCTGCCCGGAAGGTATATA No data
Right 905341340 1:37280037-37280059 AAGCAGAGCCAACAAGAGATTGG No data
905341338_905341340 -9 Left 905341338 1:37280023-37280045 CCCGGAAGGTATATAAGCAGAGC No data
Right 905341340 1:37280037-37280059 AAGCAGAGCCAACAAGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905341340 Original CRISPR AAGCAGAGCCAACAAGAGAT TGG Intergenic
No off target data available for this crispr