ID: 905342545

View in Genome Browser
Species Human (GRCh38)
Location 1:37289267-37289289
Sequence AGGCTGCGGTTGGCTGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905342545_905342551 3 Left 905342545 1:37289267-37289289 CCACCTCCAGCCAACCGCAGCCT No data
Right 905342551 1:37289293-37289315 TCTGCTGACCCACAGATCAATGG No data
905342545_905342554 26 Left 905342545 1:37289267-37289289 CCACCTCCAGCCAACCGCAGCCT No data
Right 905342554 1:37289316-37289338 AAATGAATGATTGCTGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905342545 Original CRISPR AGGCTGCGGTTGGCTGGAGG TGG (reversed) Intergenic
No off target data available for this crispr