ID: 905342547

View in Genome Browser
Species Human (GRCh38)
Location 1:37289273-37289295
Sequence AGATGTAGGCTGCGGTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905342547_905342554 20 Left 905342547 1:37289273-37289295 CCAGCCAACCGCAGCCTACATCT No data
Right 905342554 1:37289316-37289338 AAATGAATGATTGCTGTTTTAGG No data
905342547_905342551 -3 Left 905342547 1:37289273-37289295 CCAGCCAACCGCAGCCTACATCT No data
Right 905342551 1:37289293-37289315 TCTGCTGACCCACAGATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905342547 Original CRISPR AGATGTAGGCTGCGGTTGGC TGG (reversed) Intergenic
No off target data available for this crispr