ID: 905342548

View in Genome Browser
Species Human (GRCh38)
Location 1:37289277-37289299
Sequence CAGCAGATGTAGGCTGCGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905342548_905342554 16 Left 905342548 1:37289277-37289299 CCAACCGCAGCCTACATCTGCTG No data
Right 905342554 1:37289316-37289338 AAATGAATGATTGCTGTTTTAGG No data
905342548_905342556 30 Left 905342548 1:37289277-37289299 CCAACCGCAGCCTACATCTGCTG No data
Right 905342556 1:37289330-37289352 TGTTTTAGGACATAGAGTTTGGG No data
905342548_905342555 29 Left 905342548 1:37289277-37289299 CCAACCGCAGCCTACATCTGCTG No data
Right 905342555 1:37289329-37289351 CTGTTTTAGGACATAGAGTTTGG No data
905342548_905342551 -7 Left 905342548 1:37289277-37289299 CCAACCGCAGCCTACATCTGCTG No data
Right 905342551 1:37289293-37289315 TCTGCTGACCCACAGATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905342548 Original CRISPR CAGCAGATGTAGGCTGCGGT TGG (reversed) Intergenic
No off target data available for this crispr