ID: 905342549

View in Genome Browser
Species Human (GRCh38)
Location 1:37289281-37289303
Sequence GGGTCAGCAGATGTAGGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905342549_905342555 25 Left 905342549 1:37289281-37289303 CCGCAGCCTACATCTGCTGACCC No data
Right 905342555 1:37289329-37289351 CTGTTTTAGGACATAGAGTTTGG No data
905342549_905342554 12 Left 905342549 1:37289281-37289303 CCGCAGCCTACATCTGCTGACCC No data
Right 905342554 1:37289316-37289338 AAATGAATGATTGCTGTTTTAGG No data
905342549_905342557 27 Left 905342549 1:37289281-37289303 CCGCAGCCTACATCTGCTGACCC No data
Right 905342557 1:37289331-37289353 GTTTTAGGACATAGAGTTTGGGG No data
905342549_905342556 26 Left 905342549 1:37289281-37289303 CCGCAGCCTACATCTGCTGACCC No data
Right 905342556 1:37289330-37289352 TGTTTTAGGACATAGAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905342549 Original CRISPR GGGTCAGCAGATGTAGGCTG CGG (reversed) Intergenic
No off target data available for this crispr