ID: 905342551

View in Genome Browser
Species Human (GRCh38)
Location 1:37289293-37289315
Sequence TCTGCTGACCCACAGATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905342548_905342551 -7 Left 905342548 1:37289277-37289299 CCAACCGCAGCCTACATCTGCTG No data
Right 905342551 1:37289293-37289315 TCTGCTGACCCACAGATCAATGG No data
905342547_905342551 -3 Left 905342547 1:37289273-37289295 CCAGCCAACCGCAGCCTACATCT No data
Right 905342551 1:37289293-37289315 TCTGCTGACCCACAGATCAATGG No data
905342546_905342551 0 Left 905342546 1:37289270-37289292 CCTCCAGCCAACCGCAGCCTACA No data
Right 905342551 1:37289293-37289315 TCTGCTGACCCACAGATCAATGG No data
905342545_905342551 3 Left 905342545 1:37289267-37289289 CCACCTCCAGCCAACCGCAGCCT No data
Right 905342551 1:37289293-37289315 TCTGCTGACCCACAGATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905342551 Original CRISPR TCTGCTGACCCACAGATCAA TGG Intergenic
No off target data available for this crispr