ID: 905342552

View in Genome Browser
Species Human (GRCh38)
Location 1:37289301-37289323
Sequence ATTCATTTCCATTGATCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905342552_905342557 7 Left 905342552 1:37289301-37289323 CCCACAGATCAATGGAAATGAAT No data
Right 905342557 1:37289331-37289353 GTTTTAGGACATAGAGTTTGGGG No data
905342552_905342559 21 Left 905342552 1:37289301-37289323 CCCACAGATCAATGGAAATGAAT No data
Right 905342559 1:37289345-37289367 AGTTTGGGGAGTGGATTGTTAGG No data
905342552_905342558 12 Left 905342552 1:37289301-37289323 CCCACAGATCAATGGAAATGAAT No data
Right 905342558 1:37289336-37289358 AGGACATAGAGTTTGGGGAGTGG No data
905342552_905342554 -8 Left 905342552 1:37289301-37289323 CCCACAGATCAATGGAAATGAAT No data
Right 905342554 1:37289316-37289338 AAATGAATGATTGCTGTTTTAGG No data
905342552_905342556 6 Left 905342552 1:37289301-37289323 CCCACAGATCAATGGAAATGAAT No data
Right 905342556 1:37289330-37289352 TGTTTTAGGACATAGAGTTTGGG No data
905342552_905342555 5 Left 905342552 1:37289301-37289323 CCCACAGATCAATGGAAATGAAT No data
Right 905342555 1:37289329-37289351 CTGTTTTAGGACATAGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905342552 Original CRISPR ATTCATTTCCATTGATCTGT GGG (reversed) Intergenic
No off target data available for this crispr