ID: 905342554

View in Genome Browser
Species Human (GRCh38)
Location 1:37289316-37289338
Sequence AAATGAATGATTGCTGTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905342548_905342554 16 Left 905342548 1:37289277-37289299 CCAACCGCAGCCTACATCTGCTG No data
Right 905342554 1:37289316-37289338 AAATGAATGATTGCTGTTTTAGG No data
905342546_905342554 23 Left 905342546 1:37289270-37289292 CCTCCAGCCAACCGCAGCCTACA No data
Right 905342554 1:37289316-37289338 AAATGAATGATTGCTGTTTTAGG No data
905342545_905342554 26 Left 905342545 1:37289267-37289289 CCACCTCCAGCCAACCGCAGCCT No data
Right 905342554 1:37289316-37289338 AAATGAATGATTGCTGTTTTAGG No data
905342553_905342554 -9 Left 905342553 1:37289302-37289324 CCACAGATCAATGGAAATGAATG No data
Right 905342554 1:37289316-37289338 AAATGAATGATTGCTGTTTTAGG No data
905342549_905342554 12 Left 905342549 1:37289281-37289303 CCGCAGCCTACATCTGCTGACCC No data
Right 905342554 1:37289316-37289338 AAATGAATGATTGCTGTTTTAGG No data
905342550_905342554 6 Left 905342550 1:37289287-37289309 CCTACATCTGCTGACCCACAGAT No data
Right 905342554 1:37289316-37289338 AAATGAATGATTGCTGTTTTAGG No data
905342552_905342554 -8 Left 905342552 1:37289301-37289323 CCCACAGATCAATGGAAATGAAT No data
Right 905342554 1:37289316-37289338 AAATGAATGATTGCTGTTTTAGG No data
905342547_905342554 20 Left 905342547 1:37289273-37289295 CCAGCCAACCGCAGCCTACATCT No data
Right 905342554 1:37289316-37289338 AAATGAATGATTGCTGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905342554 Original CRISPR AAATGAATGATTGCTGTTTT AGG Intergenic
No off target data available for this crispr