ID: 905342769

View in Genome Browser
Species Human (GRCh38)
Location 1:37290644-37290666
Sequence GAGGGTACAAAAATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905342769_905342781 20 Left 905342769 1:37290644-37290666 CCTTCCTCCATTTTTGTACCCTC No data
Right 905342781 1:37290687-37290709 TGTCCTCCCCCTGCCCACCCCGG No data
905342769_905342782 21 Left 905342769 1:37290644-37290666 CCTTCCTCCATTTTTGTACCCTC No data
Right 905342782 1:37290688-37290710 GTCCTCCCCCTGCCCACCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905342769 Original CRISPR GAGGGTACAAAAATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr