ID: 905344485

View in Genome Browser
Species Human (GRCh38)
Location 1:37302173-37302195
Sequence GGGTGTCACCATAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905344485_905344494 19 Left 905344485 1:37302173-37302195 CCAGCCTCCTTATGGTGACACCC No data
Right 905344494 1:37302215-37302237 GAGCCAGAGATTGTCCATATGGG No data
905344485_905344493 18 Left 905344485 1:37302173-37302195 CCAGCCTCCTTATGGTGACACCC No data
Right 905344493 1:37302214-37302236 GGAGCCAGAGATTGTCCATATGG No data
905344485_905344489 -3 Left 905344485 1:37302173-37302195 CCAGCCTCCTTATGGTGACACCC No data
Right 905344489 1:37302193-37302215 CCCACTCACCAGTGCCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905344485 Original CRISPR GGGTGTCACCATAAGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr