ID: 905344511

View in Genome Browser
Species Human (GRCh38)
Location 1:37302279-37302301
Sequence CTGGATCTTGAGAGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905344503_905344511 4 Left 905344503 1:37302252-37302274 CCTAGAGCAGGATGAGAAGGAGG No data
Right 905344511 1:37302279-37302301 CTGGATCTTGAGAGGGAAATGGG No data
905344500_905344511 11 Left 905344500 1:37302245-37302267 CCCAAAGCCTAGAGCAGGATGAG No data
Right 905344511 1:37302279-37302301 CTGGATCTTGAGAGGGAAATGGG No data
905344501_905344511 10 Left 905344501 1:37302246-37302268 CCAAAGCCTAGAGCAGGATGAGA No data
Right 905344511 1:37302279-37302301 CTGGATCTTGAGAGGGAAATGGG No data
905344498_905344511 15 Left 905344498 1:37302241-37302263 CCCTCCCAAAGCCTAGAGCAGGA No data
Right 905344511 1:37302279-37302301 CTGGATCTTGAGAGGGAAATGGG No data
905344496_905344511 27 Left 905344496 1:37302229-37302251 CCATATGGGTCACCCTCCCAAAG No data
Right 905344511 1:37302279-37302301 CTGGATCTTGAGAGGGAAATGGG No data
905344499_905344511 14 Left 905344499 1:37302242-37302264 CCTCCCAAAGCCTAGAGCAGGAT No data
Right 905344511 1:37302279-37302301 CTGGATCTTGAGAGGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905344511 Original CRISPR CTGGATCTTGAGAGGGAAAT GGG Intergenic
No off target data available for this crispr