ID: 905344593

View in Genome Browser
Species Human (GRCh38)
Location 1:37302641-37302663
Sequence TTGGTTTCCCTCCACCAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905344584_905344593 20 Left 905344584 1:37302598-37302620 CCCACGAGTGTGGCACACAGGAC No data
Right 905344593 1:37302641-37302663 TTGGTTTCCCTCCACCAGGTAGG No data
905344591_905344593 -6 Left 905344591 1:37302624-37302646 CCTAGATGCAATGGGATTTGGTT No data
Right 905344593 1:37302641-37302663 TTGGTTTCCCTCCACCAGGTAGG No data
905344585_905344593 19 Left 905344585 1:37302599-37302621 CCACGAGTGTGGCACACAGGACC No data
Right 905344593 1:37302641-37302663 TTGGTTTCCCTCCACCAGGTAGG No data
905344590_905344593 -5 Left 905344590 1:37302623-37302645 CCCTAGATGCAATGGGATTTGGT No data
Right 905344593 1:37302641-37302663 TTGGTTTCCCTCCACCAGGTAGG No data
905344583_905344593 21 Left 905344583 1:37302597-37302619 CCCCACGAGTGTGGCACACAGGA No data
Right 905344593 1:37302641-37302663 TTGGTTTCCCTCCACCAGGTAGG No data
905344580_905344593 28 Left 905344580 1:37302590-37302612 CCCTGCACCCCACGAGTGTGGCA No data
Right 905344593 1:37302641-37302663 TTGGTTTCCCTCCACCAGGTAGG No data
905344581_905344593 27 Left 905344581 1:37302591-37302613 CCTGCACCCCACGAGTGTGGCAC No data
Right 905344593 1:37302641-37302663 TTGGTTTCCCTCCACCAGGTAGG No data
905344588_905344593 -2 Left 905344588 1:37302620-37302642 CCACCCTAGATGCAATGGGATTT No data
Right 905344593 1:37302641-37302663 TTGGTTTCCCTCCACCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905344593 Original CRISPR TTGGTTTCCCTCCACCAGGT AGG Intergenic
No off target data available for this crispr