ID: 905345031

View in Genome Browser
Species Human (GRCh38)
Location 1:37305622-37305644
Sequence GGAAGCCTCCAGCACCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905345031_905345036 -1 Left 905345031 1:37305622-37305644 CCCAGTGGGTGCTGGAGGCTTCC No data
Right 905345036 1:37305644-37305666 CCAGCACCTTTCCTACGCCTGGG No data
905345031_905345040 23 Left 905345031 1:37305622-37305644 CCCAGTGGGTGCTGGAGGCTTCC No data
Right 905345040 1:37305668-37305690 AGCCCCAGCCCAGCCCCAGCAGG No data
905345031_905345034 -2 Left 905345031 1:37305622-37305644 CCCAGTGGGTGCTGGAGGCTTCC No data
Right 905345034 1:37305643-37305665 CCCAGCACCTTTCCTACGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905345031 Original CRISPR GGAAGCCTCCAGCACCCACT GGG (reversed) Intergenic
No off target data available for this crispr