ID: 905345034

View in Genome Browser
Species Human (GRCh38)
Location 1:37305643-37305665
Sequence CCCAGCACCTTTCCTACGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905345023_905345034 22 Left 905345023 1:37305598-37305620 CCTGGCCCCTCATGCAGAGGAGC No data
Right 905345034 1:37305643-37305665 CCCAGCACCTTTCCTACGCCTGG No data
905345026_905345034 15 Left 905345026 1:37305605-37305627 CCTCATGCAGAGGAGCACCCAGT No data
Right 905345034 1:37305643-37305665 CCCAGCACCTTTCCTACGCCTGG No data
905345031_905345034 -2 Left 905345031 1:37305622-37305644 CCCAGTGGGTGCTGGAGGCTTCC No data
Right 905345034 1:37305643-37305665 CCCAGCACCTTTCCTACGCCTGG No data
905345032_905345034 -3 Left 905345032 1:37305623-37305645 CCAGTGGGTGCTGGAGGCTTCCC No data
Right 905345034 1:37305643-37305665 CCCAGCACCTTTCCTACGCCTGG No data
905345025_905345034 16 Left 905345025 1:37305604-37305626 CCCTCATGCAGAGGAGCACCCAG No data
Right 905345034 1:37305643-37305665 CCCAGCACCTTTCCTACGCCTGG No data
905345024_905345034 17 Left 905345024 1:37305603-37305625 CCCCTCATGCAGAGGAGCACCCA No data
Right 905345034 1:37305643-37305665 CCCAGCACCTTTCCTACGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905345034 Original CRISPR CCCAGCACCTTTCCTACGCC TGG Intergenic
No off target data available for this crispr