ID: 905345035

View in Genome Browser
Species Human (GRCh38)
Location 1:37305644-37305666
Sequence CCCAGGCGTAGGAAAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905345035_905345046 10 Left 905345035 1:37305644-37305666 CCAGCACCTTTCCTACGCCTGGG No data
Right 905345046 1:37305677-37305699 CCAGCCCCAGCAGGTGTGTTTGG No data
905345035_905345040 1 Left 905345035 1:37305644-37305666 CCAGCACCTTTCCTACGCCTGGG No data
Right 905345040 1:37305668-37305690 AGCCCCAGCCCAGCCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905345035 Original CRISPR CCCAGGCGTAGGAAAGGTGC TGG (reversed) Intergenic
No off target data available for this crispr