ID: 905345038

View in Genome Browser
Species Human (GRCh38)
Location 1:37305655-37305677
Sequence GGCTGGGGCTGCCCAGGCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905345038_905345040 -10 Left 905345038 1:37305655-37305677 CCTACGCCTGGGCAGCCCCAGCC No data
Right 905345040 1:37305668-37305690 AGCCCCAGCCCAGCCCCAGCAGG No data
905345038_905345046 -1 Left 905345038 1:37305655-37305677 CCTACGCCTGGGCAGCCCCAGCC No data
Right 905345046 1:37305677-37305699 CCAGCCCCAGCAGGTGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905345038 Original CRISPR GGCTGGGGCTGCCCAGGCGT AGG (reversed) Intergenic
No off target data available for this crispr