ID: 905345040

View in Genome Browser
Species Human (GRCh38)
Location 1:37305668-37305690
Sequence AGCCCCAGCCCAGCCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905345031_905345040 23 Left 905345031 1:37305622-37305644 CCCAGTGGGTGCTGGAGGCTTCC No data
Right 905345040 1:37305668-37305690 AGCCCCAGCCCAGCCCCAGCAGG No data
905345037_905345040 -5 Left 905345037 1:37305650-37305672 CCTTTCCTACGCCTGGGCAGCCC No data
Right 905345040 1:37305668-37305690 AGCCCCAGCCCAGCCCCAGCAGG No data
905345035_905345040 1 Left 905345035 1:37305644-37305666 CCAGCACCTTTCCTACGCCTGGG No data
Right 905345040 1:37305668-37305690 AGCCCCAGCCCAGCCCCAGCAGG No data
905345032_905345040 22 Left 905345032 1:37305623-37305645 CCAGTGGGTGCTGGAGGCTTCCC No data
Right 905345040 1:37305668-37305690 AGCCCCAGCCCAGCCCCAGCAGG No data
905345033_905345040 2 Left 905345033 1:37305643-37305665 CCCAGCACCTTTCCTACGCCTGG No data
Right 905345040 1:37305668-37305690 AGCCCCAGCCCAGCCCCAGCAGG No data
905345038_905345040 -10 Left 905345038 1:37305655-37305677 CCTACGCCTGGGCAGCCCCAGCC No data
Right 905345040 1:37305668-37305690 AGCCCCAGCCCAGCCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905345040 Original CRISPR AGCCCCAGCCCAGCCCCAGC AGG Intergenic
No off target data available for this crispr