ID: 905346268

View in Genome Browser
Species Human (GRCh38)
Location 1:37313130-37313152
Sequence AGCTCCTCAGACCCCCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905346261_905346268 12 Left 905346261 1:37313095-37313117 CCTGGAGGAGGGGGCCCCAGAAT No data
Right 905346268 1:37313130-37313152 AGCTCCTCAGACCCCCACCCAGG No data
905346265_905346268 -4 Left 905346265 1:37313111-37313133 CCAGAATGTAGGAACCCTAAGCT No data
Right 905346268 1:37313130-37313152 AGCTCCTCAGACCCCCACCCAGG No data
905346263_905346268 -2 Left 905346263 1:37313109-37313131 CCCCAGAATGTAGGAACCCTAAG No data
Right 905346268 1:37313130-37313152 AGCTCCTCAGACCCCCACCCAGG No data
905346256_905346268 25 Left 905346256 1:37313082-37313104 CCTTAATTATTTGCCTGGAGGAG No data
Right 905346268 1:37313130-37313152 AGCTCCTCAGACCCCCACCCAGG No data
905346264_905346268 -3 Left 905346264 1:37313110-37313132 CCCAGAATGTAGGAACCCTAAGC No data
Right 905346268 1:37313130-37313152 AGCTCCTCAGACCCCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905346268 Original CRISPR AGCTCCTCAGACCCCCACCC AGG Intergenic