ID: 905350479

View in Genome Browser
Species Human (GRCh38)
Location 1:37342860-37342882
Sequence GGTGTGGTTATGCATTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905350479_905350483 28 Left 905350479 1:37342860-37342882 CCTTCAAAATGCATAACCACACC No data
Right 905350483 1:37342911-37342933 CTGCTCTCTGTAACCCCTAGAGG No data
905350479_905350481 -6 Left 905350479 1:37342860-37342882 CCTTCAAAATGCATAACCACACC No data
Right 905350481 1:37342877-37342899 CACACCTGCACATTAACTCAAGG No data
905350479_905350484 29 Left 905350479 1:37342860-37342882 CCTTCAAAATGCATAACCACACC No data
Right 905350484 1:37342912-37342934 TGCTCTCTGTAACCCCTAGAGGG No data
905350479_905350485 30 Left 905350479 1:37342860-37342882 CCTTCAAAATGCATAACCACACC No data
Right 905350485 1:37342913-37342935 GCTCTCTGTAACCCCTAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905350479 Original CRISPR GGTGTGGTTATGCATTTTGA AGG (reversed) Intergenic
No off target data available for this crispr