ID: 905351340

View in Genome Browser
Species Human (GRCh38)
Location 1:37348634-37348656
Sequence CGGGATACACAGATGAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905351340_905351346 2 Left 905351340 1:37348634-37348656 CCCAGGTTCATCTGTGTATCCCG No data
Right 905351346 1:37348659-37348681 CTCCCCAAGGCTAAGAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905351340 Original CRISPR CGGGATACACAGATGAACCT GGG (reversed) Intergenic
No off target data available for this crispr