ID: 905352147

View in Genome Browser
Species Human (GRCh38)
Location 1:37355239-37355261
Sequence GGGTATAGATTCCTCCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905352147_905352150 27 Left 905352147 1:37355239-37355261 CCAGGGTGGAGGAATCTATACCC No data
Right 905352150 1:37355289-37355311 GTGCAGTACATGTTTATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905352147 Original CRISPR GGGTATAGATTCCTCCACCC TGG (reversed) Intergenic
No off target data available for this crispr