ID: 905352402

View in Genome Browser
Species Human (GRCh38)
Location 1:37356706-37356728
Sequence CCTCACCTGCAGCAGCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905352402_905352411 4 Left 905352402 1:37356706-37356728 CCCCCCAGCTGCTGCAGGTGAGG No data
Right 905352411 1:37356733-37356755 GTCACCATCAAGCCATCAGTGGG No data
905352402_905352414 17 Left 905352402 1:37356706-37356728 CCCCCCAGCTGCTGCAGGTGAGG No data
Right 905352414 1:37356746-37356768 CATCAGTGGGACAAAAAACTTGG No data
905352402_905352410 3 Left 905352402 1:37356706-37356728 CCCCCCAGCTGCTGCAGGTGAGG No data
Right 905352410 1:37356732-37356754 TGTCACCATCAAGCCATCAGTGG No data
905352402_905352415 18 Left 905352402 1:37356706-37356728 CCCCCCAGCTGCTGCAGGTGAGG No data
Right 905352415 1:37356747-37356769 ATCAGTGGGACAAAAAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905352402 Original CRISPR CCTCACCTGCAGCAGCTGGG GGG (reversed) Intergenic
No off target data available for this crispr