ID: 905352410

View in Genome Browser
Species Human (GRCh38)
Location 1:37356732-37356754
Sequence TGTCACCATCAAGCCATCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905352407_905352410 0 Left 905352407 1:37356709-37356731 CCCAGCTGCTGCAGGTGAGGGCC No data
Right 905352410 1:37356732-37356754 TGTCACCATCAAGCCATCAGTGG No data
905352408_905352410 -1 Left 905352408 1:37356710-37356732 CCAGCTGCTGCAGGTGAGGGCCT No data
Right 905352410 1:37356732-37356754 TGTCACCATCAAGCCATCAGTGG No data
905352398_905352410 23 Left 905352398 1:37356686-37356708 CCACCTGAGCTGCCTCAGTGCCC No data
Right 905352410 1:37356732-37356754 TGTCACCATCAAGCCATCAGTGG No data
905352397_905352410 24 Left 905352397 1:37356685-37356707 CCCACCTGAGCTGCCTCAGTGCC No data
Right 905352410 1:37356732-37356754 TGTCACCATCAAGCCATCAGTGG No data
905352406_905352410 1 Left 905352406 1:37356708-37356730 CCCCAGCTGCTGCAGGTGAGGGC No data
Right 905352410 1:37356732-37356754 TGTCACCATCAAGCCATCAGTGG No data
905352400_905352410 11 Left 905352400 1:37356698-37356720 CCTCAGTGCCCCCCAGCTGCTGC No data
Right 905352410 1:37356732-37356754 TGTCACCATCAAGCCATCAGTGG No data
905352404_905352410 2 Left 905352404 1:37356707-37356729 CCCCCAGCTGCTGCAGGTGAGGG No data
Right 905352410 1:37356732-37356754 TGTCACCATCAAGCCATCAGTGG No data
905352402_905352410 3 Left 905352402 1:37356706-37356728 CCCCCCAGCTGCTGCAGGTGAGG No data
Right 905352410 1:37356732-37356754 TGTCACCATCAAGCCATCAGTGG No data
905352399_905352410 20 Left 905352399 1:37356689-37356711 CCTGAGCTGCCTCAGTGCCCCCC No data
Right 905352410 1:37356732-37356754 TGTCACCATCAAGCCATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905352410 Original CRISPR TGTCACCATCAAGCCATCAG TGG Intergenic
No off target data available for this crispr